Current IMR Pricing

Currently Available Amplicon Targets (and primer sets)

16S Targets 18S Targets ITS Targets
Bacteria+Archaea Bacteria-specific Archaea-specific Cyano-specific Eukaryotes Fungi-specific
16S V4-V5**
16S V6-V8 16S V6-V8 16S V3-V4 18S V4 ITS2
515FB = GTGYCAGCMGCCGCGGTAA
926R = CCGYCAATTYMTTTRAGTTT
B969F = ACGCGHNRAACCTTACC
BA1406R = ACGGGCRGTGWGTRCAA
A956F = TYAATYGGANTCAACRCC
A1401R = CRGTGWGTRCAAGGRGCA
CYA359F = GGGGAATYTTCCGCAATGGG
CYA781R = GACTACWGGGGTATCTAATCCCWTT
E572F = CYGCGGTAATTCCAGCTC
E1009R = AYGGTATCTRATCRTCTTYG
ITS86F = GTGAATCATCGAATCTTTGAA
ITS4R = TCCTCCGCTTATTGATATGC
** Note that the V4-V5 primer set will also amplify 18S, so it is not recommended for samples with substantial "host" contamination.

 16S/18S/ITS Amplicons (per sample, per amplicon) - MiSeq (300+300 bp PE) - Academic

<50 samples 50-200 samples >200 samples1
Library Preparation + Sequencing (max. 50k reads/sample2) $30 $25 $20
      or 2X depth (max. 100k reads/sample2) $45 $38 $30
DNA Extraction3 $15 $15 $15
Standard Bioinformatics Analysis Pipeline4 $500/project $750/project $1000/project

 16S/18S/ITS Amplicons (per sample, per amplicon) - MiSeq (300+300 bp PE) - Commercial

<50 samples 50-200 samples >200 samples1
Library Preparation + Sequencing (max. 50k reads/sample2) $40 $35 $30
      or 2X depth (max. 100k reads/sample2) $60 $53 $45
DNA Extraction3 $16 $16 $16
Standard Bioinformatics Analysis Pipeline4 $750/project $1000/project $1500/project

 Client-Prepared Pool of Amplicons (per whole run) - MiSeq (300+300 bp PE)

Academic Commercial
Per run Per run
MiSeq Sequencing Run (~20-25 M PE reads & 12-15 Gb) $3200 $4700
Note: For clients wishing to use part of a run with a prepared pool of amplicons, simply divide 380 by your sample # x the above price to determine your pool cost (this is for a 1X depth, simply double the amount for 2X).

 Small Genomes (~100X typical 5 Mb genome) - MiSeq (300+300 bp PE) - Resequencing

Academic Commercial
Per run of 24 Per genome Per run of 24 Per genome
Library Prep. + Sequencing (~0.9 M PE reads = 1.8 M single reads & 540 Mb/genome)$6000 $250 $8400 $350
Custom Bioinformatics Analysis inquire inquire

 Small Genomes (~400X typical 5 Mb genome) - PacBio Sequel (long reads) - De novo Assembly

Academic Commercial
Per run of 6 Per genome Per run of 6 Per genome
Library Prep. + Sequencing (~2 Gb/genome) $3900 $650 $5700 $950
Custom Bioinformatics Analysis inquire inquire
Note: PacBio pricing is currently introductory and could change within 2019 as we perfect the system/depths of coverage.

 Mid-Sized Genomes (~400X typical 15-30 Mb genome) - PacBio Sequel (long reads) - De novo Assembly

Academic Commercial
Per cell Per cell
Library Prep. + Sequencing (~12 Gb and ~425k reads/cell)$2500 $3700
Custom Bioinformatics Analysis inquire inquire
Note: PacBio pricing is currently introductory and could change within 2019 as we perfect the system/depths of coverage.

 Metagenomes - MiSeq (300+300 bp PE) - Special Purpose (ex: usually only if needing assembly)

Academic Commercial
Per run of 6 Per sample Per run of 6 Per sample
Library Prep. + Sequencing (~3.5 M PE reads = 7 M single reads & 2.1 Gb/sample) $4500 $750 $6300 $1050
DNA Extraction3 $90 $15 $96 $16
Standard Bioinformatics Analysis Pipeline5 $750/project $1500/project

 Metagenomes - NextSeq (150+150 bp PE) - Regular Depths

Academic Commercial
Per run of (X) Per sample Per run of (X) Per sample
Library Prep. + Sequencing (~4 M PE reads = 8 M single reads & 1.2 Gb/sample) $14400 (96) $150 $21120 (96) $220
      or 2X depth (~8 M PE reads = 16 M single reads & 2.4 Gb/sample) $12000 (48) $250 $15360 (48) $320
      or 3X depth (~12 M PE reads = 24 M single reads & 3.6 Gb/sample) $11200 (32) $350 $13440 (32) $420
      or 4X depth (~16 M PE reads = 32 M single reads & 4.8 Gb/sample) $10800 (24) $450 $12480 (24) $520
DNA Extraction3 variable $15 variable $16
Standard Bioinformatics Analysis Pipeline5 $750/project $1500/project

 Metagenomes - NextSeq (150+150 bp PE) - High Depths

Academic Commercial
Per run of (X) Per run of (X)
Library Prep. + Sequencing (Whole run = ~400 M PE reads = 800 M single reads & 120 Gb) - -
      <6 samples (80+ M PE reads = 160+ M single reads) $7000 (<6) $10500 (<6)
      6-8 samples (~50-67 M PE reads = 100-133 M single reads) $8000 (6-8) $12000 (6-8)
      9-10 samples (~40-44 M PE reads = 80-88 M single reads) $9000 (9-10) $13500 (9-10)
      11-12 samples (~33-36 M PE reads = 67-73 M single reads) $10000 (11-12) $15000 (11-12)
DNA Extraction3 variable variable
Standard Bioinformatics Analysis Pipeline5 $750/project $1500/project

 (Meta)transcriptomes - NextSeq (150+150 bp PE) - under development (tentative pricing)

Academic Commercial
Per run of 24 Per sample Per run of 24 Per sample
Library Prep. + Sequencing (~17 M PE reads = 33 M single reads & 5 Gb/sample) $13200 $550 $19200 $800
RNA Extraction3 $360 $15 $384 $16
Standard Bioinformatics Analysis Pipeline5 $750/project $1500/project

 Iso-Seq - PacBio Sequel (long reads) - Full-Length Isoform Transcripts

Academic Commercial
Per cell Per cell
Library Prep. + Sequencing (~12 Gb and ~425k reads/cell)$2500 $3700
Standard PacBio Iso-Seq Pipeline5 inquire inquire
Note: PacBio pricing is currently introductory and could change within 2019 as we perfect the system/depths of coverage.

Notes/Details

1. One control well is required per 96-well PCR library plate, hence a maximum of 4x95 = 380 samples can be done together on one MiSeq run (190 for a 2X run). Any batches >380 will need to be spread across mutliple sequencing runs.

2. These are generally maximum raw read outputs you will received, but there is inherent variability in MiSeq runs, meaning averages can be closer to 30k (1X) & 60k (2X).

3. Extra costs may be incurred if samples, due to their nature, require more specialized (length, cost, etc.) extraction procedures.

4. & 5. Details of our amplicon and metagenomics pipelines are available at https://github.com/mlangill/microbiome_helper, but a summary of the major deliverables clients will receive (analyses will require a "mapping file" from the clients containing any relevant metadata for the study) are available on our Protocols page.

Custom Bioinformatics: Additional bioinformatic analyses can be requested at an hourly rate or through research collaboration. Please contact us for more details.

Customs primers/amplicons: Beyond the 16S/18S/ITS amplicons offered "in-stock", essentially any PCR amplicon (max. size ~550 bp, best ~450-500 bp) can be adapted to our MiSeq system. Please consults us for primer design/protocol details.

Processing time: Time to completion may be variable depending the amount of other partial projects in the queue - this generally so longer applies to amplicons as we are at capacity, but occurs more when submitting small numbers of samples for metagenomics runs (<<96 for NextSeq).

Payment: Payment is required within 30 days of receiving your invoice, only after completion of work (ie: delivery of data). All payments are final and no refunds are accepted.